![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3143 |
|||||
Accession | MI0014167 (change log) | ||||
Symbol | HGNC:MIR3143 | ||||
Description | Homo sapiens miR-3143 stem-loop | ||||
Stem-loop |
u ---c uuuc gg 5' uaga aacauuguaaag gcuuc gc u |||| |||||||||||| ||||| || 3' aucu uuguaacauuuc cgagg cg u - ucaa ---u gg |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-3143 |
|
Accession | MIMAT0015012 |
Sequence |
4 - auaacauuguaaagcgcuucuuucg - 28 |
Deep sequencing | 623 reads, 65 experiments |
Evidence | experimental; Illumina [1-2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|