Stem-loop sequence hsa-mir-3145

AccessionMI0014170 (change log)
Symbol HGNC:MIR3145
DescriptionHomo sapiens miR-3145 stem-loop
Gene family MIPF0001427; mir-3145
Literature search

3 open access papers mention hsa-mir-3145
(7 sentences)

Stem-loop 
                c               ---      g u 
5' uauaugaguucaa uccaaacacucaaaa   cucauu u g
   ||||||||||||| |||||||||||||||   |||||| | a
3' auaugcucaaguu agguuugugaguuuu   gaguaa g a
                a               aua      g u
Get sequence
Deep sequencing
213 reads, 0 reads per million, 53 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 138435213-138435294 [-]
intergenic
Database links

Mature sequence hsa-miR-3145-5p

Accession MIMAT0019205
Sequence

12 -  

aacuccaaacacucaaaacuca

 - 33

Get sequence
Deep sequencing27 reads, 22 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-3145-3p

Accession MIMAT0015016
Previous IDshsa-miR-3145
Sequence

49 -  

agauauuuugaguguuuggaauug

 - 72

Get sequence
Deep sequencing179 reads, 36 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).