![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-1273c |
|||||
Accession | MI0014171 (change log) | ||||
Symbol | HGNC:MIR1273C | ||||
Description | Homo sapiens miR-1273c stem-loop | ||||
Gene family | MIPF0001481; mir-1273c | ||||
Literature search |
![]()
6 open access papers mention hsa-mir-1273c | ||||
Stem-loop |
ug c a c uuuu 5' cagc ugggcgaca aacgagac cugucuu u |||| ||||||||| |||||||| ||||||| u 3' gucg acccguugu uugcucug gacagag u ag a c a ucuu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-1273c |
|
Accession | MIMAT0015017 |
Sequence |
10 - ggcgacaaaacgagacccuguc - 31 |
Deep sequencing | 579 reads, 99 experiments |
Evidence | experimental; Illumina [1-2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
2 |
PMID:20224791
"Discovery of novel microRNAs in female reproductive tract using next generation sequencing"
PLoS One. 5:e9637(2010).
|