Stem-loop sequence hsa-mir-548v

AccessionMI0014174 (change log)
Symbol HGNC:MIR548V
DescriptionHomo sapiens miR-548v stem-loop
Gene family MIPF0000317; mir-548
Literature search

43 open access papers mention hsa-mir-548v
(151 sentences)

Stem-loop 
       c      u a             cg     --  ca 
5' aaua uagguu g gcaaaaguaauug  guuuu  gc  u
   |||| |||||| | |||||||||||||  |||||  ||   
3' uuau auccga c cguuuucauugac  cgaaa  cg  c
       a      c a             au     ac  ua
Get sequence
Deep sequencing
12173 reads, 9.86 reads per million, 142 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 17681578-17681657 [-]
antisense
OTTHUMT00000374850 ; RP11-156K13.1-001; intron 1
ENST00000522768 ; RP11-156K13.1-001; intron 1
Database links

Mature sequence hsa-miR-548v

Accession MIMAT0015020
Sequence

49 -  

agcuacaguuacuuuugcacca

 - 70

Get sequence
Deep sequencing464 reads, 93 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).