![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-548v |
|||||
Accession | MI0014174 (change log) | ||||
Symbol | HGNC:MIR548V | ||||
Description | Homo sapiens miR-548v stem-loop | ||||
Gene family | MIPF0000317; mir-548 | ||||
Literature search |
![]()
43 open access papers mention hsa-mir-548v | ||||
Stem-loop |
c u a cg -- ca 5' aaua uagguu g gcaaaaguaauug guuuu gc u |||| |||||| | ||||||||||||| ||||| || 3' uuau auccga c cguuuucauugac cgaaa cg c a c a au ac ua |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-548v |
|
Accession | MIMAT0015020 |
Sequence |
49 - agcuacaguuacuuuugcacca - 70 |
Deep sequencing | 464 reads, 93 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|