![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3150a |
||||||
Accession | MI0014177 (change log) | |||||
Previous IDs | hsa-mir-3150 | |||||
Symbol | HGNC:MIR3150A | |||||
Description | Homo sapiens miR-3150a stem-loop | |||||
Gene family | MIPF0001102; mir-3150 | |||||
Literature search |
1 open access papers mention hsa-mir-3150a | |||||
Stem-loop |
c a c a 5' gggaagcaggccaaccucga gaucuccucagc c ug a |||||||||||||||||||| |||||||||||| | || c 3' ccuuucguccgguuggagcu cuagaggggucg g ac g c - a c |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-3150a-5p |
|
Accession | MIMAT0019206 |
Sequence |
12 - caaccucgacgaucuccucagc - 33 |
Deep sequencing | 212 reads, 39 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
Mature sequence hsa-miR-3150a-3p |
|
Accession | MIMAT0015023 |
Previous IDs | hsa-miR-3150 |
Sequence |
49 - cuggggagauccucgagguugg - 70 |
Deep sequencing | 179 reads, 42 experiments |
Evidence | experimental; Illumina [1-2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|