Stem-loop hsa-mir-3154

Accession

MI0014182

Symbol

HGNC: MIR3154

Description

Homo sapiens hsa-mir-3154 precursor miRNA

Gene family

MIPF0001387; mir-3154

Literature search

1 open access papers mention hsa-mir-3154
(1 sentences)

Sequence

155 reads, 56 reads per million, 32 experiments

ggccccuccuucucagccccagcucccgcucaccccugccacgucaaaggaggCAGAAGGGGAGUUGGGAGCAGAgaggggacc
((((((((..(((..((((((((((((.((.....(((((.(......)..))))).)))))))))))).))))))))))).))

Structure

  -      cu   ca  -          g  caccc     -a gu 
gg ccccuc  ucu  gc cccagcuccc cu     cugcc  c  c
|| ||||||  |||  || |||||||||| ||     |||||  |   
cc ggggag  AGA  CG GGGUUGAGGG GA     GACgg  g  a
  a      --   --  A          -  ----A     ag aa 

Annotation confidence Not enough data

Comments

Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method [1]. Goff et al. [2] and Stark et al. [3] later validated its expression in human using high-throughput sequencing.

Genome context

chr9: 128244947-128245030 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from hsa-mir-3154

Mature hsa-miR-3154

• Accession: MIMAT0015028
• Description: Homo sapiens hsa-miR-3154 mature miRNA
• Sequence: 54 - CAGAAGGGGAGUUGGGAGCAGA - 75
• Evidence: experimental ; SOLiD [2], Illumina [3-5]

References

1. PubMed ID: 16954537
   Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
   "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
   "Genome Res (2006) 16:1289-1298


2. PubMed ID: 19784364
   Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors
   Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP
   PLoS One (2009) 4:e7192


3. PubMed ID: 20300190
   Characterization of the Melanoma miRNAome by Deep Sequencing
   "Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK"
   "PLoS One (2010) 5:e9685


4. PubMed ID: 21606961
   Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia
   "Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML"
   "Leukemia (2011) 25:1389-1399


5. PubMed ID: 22454130
   Transcription factors are targeted by differentially expressed miRNAs in primates
   "Dannemann M, Prufer K, Lizano E, Nickel B, Burbano HA, Kelso J"
   "Genome Biol Evol (2012) 4:552-564