![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3156-1 |
|||||
Accession | MI0014184 (change log) | ||||
Symbol | HGNC:MIR3156-1 | ||||
Description | Homo sapiens miR-3156-1 stem-loop | ||||
Gene family | MIPF0000891; mir-3156 | ||||
Literature search |
3 open access papers mention hsa-mir-3156-1 | ||||
Stem-loop |
- a uuuac 5' gcaga agaaagaucuggaagugggag cacu u ||||| ||||||||||||||||||||| |||| 3' ugucu ucuuucuagaccuucacccuc guga a c g uauau |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-3156-5p |
|
Accession | MIMAT0015030 |
Previous IDs | hsa-miR-3156 |
Sequence |
8 - aaagaucuggaagugggagaca - 29 |
Deep sequencing | 237 reads, 18 experiments |
Evidence | experimental; Illumina [1-2] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-3156-3p |
|
Accession | MIMAT0019209 |
Sequence |
49 - cucccacuuccagaucuuucu - 69 |
Deep sequencing | 48 reads, 19 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
References |
|
1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|