![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3157 |
|||||
Accession | MI0014185 (change log) | ||||
Symbol | HGNC:MIR3157 | ||||
Description | Homo sapiens miR-3157 stem-loop | ||||
Literature search |
3 open access papers mention hsa-mir-3157 | ||||
Stem-loop |
c u ugcu ug g a 5' gggaagggcuucagc aggcuag gcaguc u u cca c ||||||||||||||| ||||||| |||||| | | ||| 3' cccuuuucgaagucg ucugauc cgucag a g ggu a a c ---u gu g c |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-3157-5p |
|
Accession | MIMAT0015031 |
Previous IDs | hsa-miR-3157 |
Sequence |
10 - uucagccaggcuagugcagucu - 31 |
Deep sequencing | 905 reads, 84 experiments |
Evidence | experimental; Illumina [1-2] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-3157-3p |
|
Accession | MIMAT0019210 |
Sequence |
58 - cugcccuagucuagcugaagcu - 79 |
Deep sequencing | 121 reads, 51 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
References |
|
1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|