![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3158-1 |
||||||
Accession | MI0014186 (change log) | |||||
Symbol | HGNC:MIR3158-1 | |||||
Description | Homo sapiens miR-3158-1 stem-loop | |||||
Gene family | MIPF0001065; mir-3158 | |||||
Stem-loop |
--- u 5' auucaggccgguccugcagagaggaagcccuucu gcu a |||||||||||||||||||||||||||||||||| ||| 3' uaaguccggccaggacgucucuccuucgggaagg ugg c uua a |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-3158-5p |
|
Accession | MIMAT0019211 |
Sequence |
13 - ccugcagagaggaagcccuuc - 33 |
Deep sequencing | 813 reads, 64 experiments |
Evidence | not experimental |
Predicted targets |
|
Mature sequence hsa-miR-3158-3p |
|
Accession | MIMAT0015032 |
Previous IDs | hsa-miR-3158 |
Sequence |
50 - aagggcuuccucucugcaggac - 71 |
Deep sequencing | 7575 reads, 133 experiments |
Evidence | experimental; Illumina [1-2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
2 |
PMID:20224791
"Discovery of novel microRNAs in female reproductive tract using next generation sequencing"
PLoS One. 5:e9637(2010).
|
3 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|