miRBase entry: hsa-mir-3160-1

Stem-loop hsa-mir-3160-1


Accession
MI0014189
Symbol
HGNC: MIR3160-1
Description
Homo sapiens hsa-mir-3160-1 precursor miRNA mir-3160
Gene
family?
RF03888; mir-3160

Literature search
1 open access papers mention hsa-mir-3160-1
(1 sentences)

Sequence

104 reads, 3 reads per million, 40 experiments
ggaccugcccugGGCUUUCUAGUCUCAGCUCUCCuccagcucagcuggucaggAGAGCUGAGACUAGAAAGCCCAgggcagguuc
((((((((((((((((((((((((((((((((((((((((...)))))..)))))))))))))))))))))))))))))))))))

Structure
                                   --     u 
ggaccugcccugGGCUUUCUAGUCUCAGCUCUCCu  ccagc  
|||||||||||||||||||||||||||||||||||  ||||| c
cuuggacgggACCCGAAAGAUCAGAGUCGAGAgga  ggucg  
                                   cu     a 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr11: 46451805-46451889 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-3160-1
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-3160-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-3160-3p

Accession MIMAT0015034
Description Homo sapiens hsa-miR-3160-3p mature miRNA
Sequence 54 - AGAGCUGAGACUAGAAAGCCCA - 75
Evidence experimental
Illumina [1-2]
Database links
Predicted targets

Mature hsa-miR-3160-5p

Accession MIMAT0019212
Description Homo sapiens hsa-miR-3160-5p mature miRNA
Sequence 13 - GGCUUUCUAGUCUCAGCUCUCC - 34
Evidence experimental
Illumina [2]

References

  1. PubMed ID: 20300190
    Characterization of the Melanoma miRNAome by Deep Sequencing
    "Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK"
    "PLoS One (2010) 5:e9685

  2. PubMed ID: 21199797
    Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene
    "Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C"
    "Cancer Res (2011) 71:78-86