|
miRBase |
|
Stem-loop sequence hsa-mir-3162 |
|||||
| Accession | MI0014192 | ||||
| Description | Homo sapiens miR-3162 stem-loop | ||||
| Stem-loop |
a a a cau ca cugacuuuuuu gggagu ga ggguggggag gaa a ||||||||||| |||||| || |||||||||| ||| gacugaaaaaa cccuca cu cccaucccuc cuu u c c c acu ug |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Database links |
|
||||
Mature sequence hsa-miR-3162-5p |
|
| Accession | MIMAT0015036 |
| Previous IDs | hsa-miR-3162 |
| Sequence |
10 - uuagggaguagaaggguggggag - 32 |
| Deep sequencing | 24 reads, 8 experiments |
| Evidence | experimental; Solexa [1-2] |
| Predicted targets |
|
Mature sequence hsa-miR-3162-3p |
|
| Accession | MIMAT0019213 |
| Sequence |
52 - ucccuaccccuccacucccca - 72 |
| Evidence | experimental; Solexa [2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
| 2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|