Stem-loop sequence hsa-mir-3177

Accession

MI0014211 (change log)

Symbol

HGNC:MIR3177

Description

Homo sapiens miR-3177 stem-loop

Literature search

2 open access papers mention hsa-mir-3177
(2 sentences)

Stem-loop

      c           aca  c     ag       cu      
5' cca gugccaugugu   ca gugcc  gcgcugu  ugaga 
   ||| |||||||||||   || |||||  |||||||  |||| c
3' ggu cacggugcaca   gu cacgg  cgugacg  gcuua 
      -           ggg  -     ca       -c      

Deep sequencing

664 reads, 0 reads per million, 58 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr16: 1734985-1735066 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000432989 ; HN1L-003; intron 1

  OTTHUMT00000109086 ; HN1L-001; intron 1

  OTTHUMT00000432990 ; HN1L-008; intron 1

  OTTHUMT00000432992 ; HN1L-006; intron 1

  OTTHUMT00000432994 ; HN1L-014; intron 1

  OTTHUMT00000432998 ; HN1L-010; intron 1

  OTTHUMT00000432999 ; HN1L-004; intron 1

  OTTHUMT00000432991 ; HN1L-002; intron 2

  OTTHUMT00000432993 ; HN1L-009; intron 2

  OTTHUMT00000432995 ; HN1L-011; intron 2

  OTTHUMT00000432996 ; HN1L-005; intron 2

  OTTHUMT00000432813 ; LA16c-431H6.6-001; intron 21

  ENST00000569256 ; HN1L-003; intron 1

  ENST00000248098 ; HN1L-001; intron 1

  ENST00000567717 ; HN1L-008; intron 1

  ENST00000561516 ; HN1L-006; intron 1

  ENST00000566742 ; HN1L-014; intron 1

  ENST00000566691 ; HN1L-010; intron 1

  ENST00000382710 ; HN1L-004; intron 1

  ENST00000562684 ; HN1L-002; intron 2

  ENST00000382711 ; HN1L-009; intron 2

  ENST00000566925 ; HN1L-011; intron 2

  ENST00000569765 ; HN1L-005; intron 2

  ENST00000454337 ; LA16c-431H6.6-001; intron 21

Database links

• EntrezGene:MIR3177
• HGNC:MIR3177
• RNAcentral:URS000075D049_9606
• miRBase Tracker:MI0014211

Mature sequence hsa-miR-3177-5p

• Accession: MIMAT0019215
• Sequence: 11 - uguguacacacgugccaggcgcu - 33
• Deep sequencing: 42 reads, 18 experiments
• Evidence: experimental; Illumina [2-3]
• Predicted targets:
  • TargetMiner:hsa-miR-3177-5p
  • TargetScanVert:hsa-miR-3177-5p
  • miRDB:hsa-miR-3177-5p

Mature sequence hsa-miR-3177-3p

• Accession: MIMAT0015054
• Previous IDs: hsa-miR-3177
• Sequence: 54 - ugcacggcacuggggacacgu - 74
• Deep sequencing: 618 reads, 54 experiments
• Evidence: experimental; Illumina [1-3]
• Database links:
  • RNAcentral:URS00003677B2_9606
• Predicted targets:
  • TargetMiner:hsa-miR-3177-3p
  • TargetScanVert:hsa-miR-3177-3p
  • miRDB:hsa-miR-3177-3p
  • microrna.org:hsa-miR-3177-3p

References

1. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3. PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).