![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3179-3 |
||||||||
Accession | MI0014221 (change log) | |||||||
Symbol | HGNC:MIR3179-3 | |||||||
Description | Homo sapiens miR-3179-3 stem-loop | |||||||
Gene family | MIPF0000900; mir-3179 | |||||||
Literature search |
3 open access papers mention hsa-mir-3179-3 | |||||||
Stem-loop |
a gcc 5' caggaucacagacguuuaaauu cacuccuucugcugu u |||||||||||||||||||||| ||||||||||||||| 3' guccuagugucugcaaauuuaa guggggaagaugacg u a aca |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: not enough data
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence hsa-miR-3179 |
|
Accession | MIMAT0015056 |
Sequence |
52 - agaaggggugaaauuuaaacgu - 73 |
Deep sequencing | 2540 reads, 62 experiments |
Evidence | experimental; Illumina [1-2] |
References |
|
1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|