![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-548w |
|||||
Accession | MI0014222 (change log) | ||||
Symbol | HGNC:MIR548W | ||||
Description | Homo sapiens miR-548w stem-loop | ||||
Gene family | MIPF0000317; mir-548 | ||||
Literature search |
![]()
41 open access papers mention hsa-mir-548w | ||||
Stem-loop |
c c u uuuca 5' gguuggugcaaaaguaa ug gg uuuugcc a ||||||||||||||||| || || ||||||| 3' cuaaccacguuuucauu ac cc aaaacgg c a a c uaaua |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-548w |
|
Accession | MIMAT0015060 |
Sequence |
10 - aaaaguaacugcgguuuuugccu - 32 |
Deep sequencing | 4938 reads, 152 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|