Stem-loop sequence hsa-mir-3200

Accession

MI0014249

Description

Homo sapiens miR-3200 stem-loop

Gene family

MIPF0001441; mir-3200

Stem-loop

  u   -    g a       aa      ca    uu   uc aa 
gg ggu cgag g aucugag  ggcgca  aggu  gug  c  u
|| ||| |||| | |||||||  ||||||  ||||  |||  |   
uc ccg gcuc u uggacuc  ucgcgu  ucca  cac  g  a
  -   u    g c       -a      --    --   cu ac 

Deep sequencing

70 reads, 13 experiments

Genome context

• Coordinates (GRCh37.p5): chr22: 31127544-31127628 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000334091 ; MTMR3-012; intron 1

  OTTHUMT00000321548 ; OSBP2-002; intron 1

  OTTHUMT00000321547 ; OSBP2-001; intron 1

  OTTHUMT00000321551 ; OSBP2-005; intron 1

  OTTHUMT00000334091 ; MTMR3-012; intron 1

  OTTHUMT00000321548 ; OSBP2-002; intron 1

  OTTHUMT00000321547 ; OSBP2-001; intron 1

  OTTHUMT00000321551 ; OSBP2-005; intron 1

  OTTHUMT00000334091 ; MTMR3-012; intron 1

  OTTHUMT00000321548 ; OSBP2-002; intron 1

  OTTHUMT00000321547 ; OSBP2-001; intron 1

  OTTHUMT00000321551 ; OSBP2-005; intron 1

  OTTHUMT00000321564 ; OSBP2-010; intron 2

  OTTHUMT00000321564 ; OSBP2-010; intron 2

  OTTHUMT00000321564 ; OSBP2-010; intron 2

  ENST00000464734 ; MTMR3-012; intron 1

  ENST00000407373 ; OSBP2-002; intron 1

  ENST00000332585 ; OSBP2-001; intron 1

  ENST00000446658 ; OSBP2-005; intron 1

  ENST00000382310 ; OSBP2-201; intron 1

  ENST00000464734 ; MTMR3-012; intron 1

  ENST00000407373 ; OSBP2-002; intron 1

  ENST00000332585 ; OSBP2-001; intron 1

  ENST00000446658 ; OSBP2-005; intron 1

  ENST00000382310 ; OSBP2-201; intron 1

  ENST00000464734 ; MTMR3-012; intron 1

  ENST00000407373 ; OSBP2-002; intron 1

  ENST00000332585 ; OSBP2-001; intron 1

  ENST00000446658 ; OSBP2-005; intron 1

  ENST00000382310 ; OSBP2-201; intron 1

  ENST00000438716 ; OSBP2-010; intron 2

  ENST00000403222 ; OSBP2-202; intron 2

  ENST00000438716 ; OSBP2-010; intron 2

  ENST00000403222 ; OSBP2-202; intron 2

  ENST00000438716 ; OSBP2-010; intron 2

  ENST00000403222 ; OSBP2-202; intron 2

Database links

• ENTREZGENE: 100422912;MIR3200

Mature sequence hsa-miR-3200-5p

• Accession: MIMAT0017392
• Sequence: 13 - aaucugagaaggcgcacaaggu - 34
• Deep sequencing: 28 reads, 6 experiments
• Evidence: experimental; Solexa [2-3,5], Northern [4]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3200-5p
  • MIRDB:hsa-miR-3200-5p
  • RNA22-HSA:hsa-miR-3200-5p
  • TARGETMINER:hsa-miR-3200-5p

Mature sequence hsa-miR-3200-3p

• Accession: MIMAT0015085
• Previous IDs: hsa-miR-3200
• Sequence: 54 - caccuugcgcuacucaggucug - 75
• Deep sequencing: 42 reads, 9 experiments
• Evidence: experimental; Solexa [1-3,5], Northern [4]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-3200-3p
  • MICRORNA.ORG:hsa-miR-3200-3p
  • MIRDB:hsa-miR-3200-3p
  • RNA22-HSA:hsa-miR-3200-3p
  • TARGETMINER:hsa-miR-3200-3p

References

1. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2. PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).
3. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).
4. PMID:20532037 "Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes" Hansen TB, Bramsen JB, Kjems J PLoS One. 5:e10961(2010).
5. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).