Stem-loop sequence bmo-mir-3286

Accession MI0014343
Description Bombyx mori miR-3286 stem-loop
Gene family MIPF0000086; mir-210
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-210_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-210 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. mir-210 has been strongly linked with the hypoxia pathway, and is upregulated in response to Hypoxia-inducible factors. It is also overexpressed in cells affected by cardiac disease and tumours. MiRNA-210 in particular, has been studied for its effects in rescuing cardiac function after myocardial infarcts via the up-regulation of angiogenesis and inhibition of cardiomyocyte apoptosis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
a    -  g   auaauc     -  -aa  c         -u   u        a  -  ga 
 ugau ug cga      gaagc cc   aa aacuauugg  cac gcacagga ua gu  a
 |||| || |||      ||||| ||   || |||||||||  ||| |||||||| || ||  a
 acug ac gcu      cuucg gg   uu uugauaacc  gug cguguucu au cg  c
-    u  a   --aaaa     u  gug  a         uu   -        c  a  uc 
Get sequence
Deep sequencing
3 reads, 1 experiments
Genome context
Coordinates (SILKDB2.0) Overlapping transcripts
nscaf1898: 4469305-4469424 [+]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-3286
bmo-mir-210 nscaf1898: 4464447-4464538 [+]
bmo-mir-3286 nscaf1898: 4469305-4469424 [+]

Mature sequence bmo-miR-3286-5p

Accession MIMAT0015472
Previous IDs bmo-miR-3286*
Sequence

30 - 

aacuauuggucacugcacaggaa

 - 52

Get sequence
Evidence experimental; SOLID [1]

Mature sequence bmo-miR-3286-3p

Accession MIMAT0015473
Previous IDs bmo-miR-3286
Sequence

72 - 

uugugcguguuccaauaguuau

 - 93

Get sequence
Deep sequencing 3 reads, 1 experiments
Evidence experimental; SOLID [1]

References

1
PMID:20229201 "Novel microRNAs in silkworm (Bombyx mori)" Cai Y, Yu X, Zhou Q, Yu C, Hu H, Liu J, Lin H, Yang J, Zhang B, Cui P, Hu S, Yu J Funct Integr Genomics. 10:405-415(2010).