Stem-loop sequence esi-MIR3454c

AccessionMI0014674 (change log)
DescriptionEctocarpus siliculosus miR3454c stem-loop
Gene family MIPF0001097; MIR3454
Stem-loop
   -       u           c    u   a     ga                 ua  a    a c ug 
5'  gaguuuu cccagcuccga ggga ggc cucgu  cuaguuccgccgccuug  uc cacg g g  u
    ||||||| ||||||||||| |||| ||| |||||  |||||||||||||||||  || |||| | |  g
3'  cuuaaga gggucgaggcu ccuu ccg gagca  gaucaaggcggcggaac  ag gugc c c  u
   a       u           a    c   c     gc                 uc  c    c - ua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EctsiV2) Overlapping transcripts
sctg_168: 254054-254192 [-]
intergenic
Clustered miRNAs
< 10kb from esi-MIR3454c
esi-MIR3454fsctg_168: 257266-257412 [-]
esi-MIR3454gsctg_168: 257004-257148 [-]
esi-MIR3454esctg_168: 256040-256186 [-]
esi-MIR3454dsctg_168: 254431-254575 [-]
esi-MIR3454csctg_168: 254054-254192 [-]
esi-MIR3454bsctg_168: 252803-252954 [-]
esi-MIR3454asctg_168: 252325-252475 [-]
Database links

Mature sequence esi-miR3454c-5p

Accession MIMAT0017751
Previous IDsesi-miR3454c
Sequence

7 - 

uucccagcuccgacgggaugg

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence esi-miR3454c-3p

Accession MIMAT0017752
Previous IDsesi-miR3454c*
Sequence

114 - 

cuuccaucggagcuggguag

 - 133

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20520714 "The Ectocarpus genome and the independent evolution of multicellularity in brown algae" Cock JM, Sterck L, Rouze P, Scornet D, Allen AE, Amoutzias G, Anthouard V, Artiguenave F, Aury JM, Badger JH, Beszteri B, Billiau K, Bonnet E, Bothwell JH, Bowler C, Boyen C, Brownlee C, Carrano CJ, Charrier B, Cho GY, Coelho SM, Collen J, Corre E, Da Sil Nature. 465:617-621(2010).