Stem-loop sequence esi-MIR3450

AccessionMI0014677 (change log)
DescriptionEctocarpus siliculosus miR3450 stem-loop
Stem-loop
   g       g   a     c     c                   c c     aa       c     ca 
5'  ucguugg uac ucgcc gacca ucuaugaaaccgggucauu c gaccg  guucguc aaagg  a
    ||||||| ||| ||||| ||||| ||||||||||||||||||| | |||||  ||||||| |||||  g
3'  agcaacc aug agcgg cuggu agauauuuuggcccaguaa g cuggc  caggcag uuucc  g
   a       -   c     u     a                   c a     cc       c     ac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EctsiV2) Overlapping transcripts
sctg_11: 959792-959931 [+]
intergenic
Database links

Mature sequence esi-miR3450-5p

Accession MIMAT0017757
Previous IDsesi-miR3450
Sequence

10 - 

uacaucgcccgaccacucuau

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence esi-miR3450-3p

Accession MIMAT0017758
Previous IDsesi-miR3450*
Sequence

113 - 

uagaauggucuggcgacguac

 - 133

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20520714 "The Ectocarpus genome and the independent evolution of multicellularity in brown algae" Cock JM, Sterck L, Rouze P, Scornet D, Allen AE, Amoutzias G, Anthouard V, Artiguenave F, Aury JM, Badger JH, Beszteri B, Billiau K, Bonnet E, Bothwell JH, Bowler C, Boyen C, Brownlee C, Carrano CJ, Charrier B, Cho GY, Coelho SM, Collen J, Corre E, Da Sil Nature. 465:617-621(2010).