Stem-loop sequence esi-MIR3460

AccessionMI0014679 (change log)
DescriptionEctocarpus siliculosus miR3460 stem-loop
Stem-loop
   a   a                                u      -aaccc       
5'  cuu cgauguaagggaaucugcagcuugugaggugc gcagaa      cccagg 
    ||| |||||||||||||||||||||||||||||||| ||||||      ||||| c
3'  gaa gcuacauucccuuggacgucgagcacuccacg cgucuu      gggucg 
   -   c                                c      cuuuuu       
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence esi-miR3460-5p

Accession MIMAT0017761
Previous IDsesi-miR3460*
Sequence

14 - 

gggaaucugcagcuugugagg

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence esi-miR3460-3p

Accession MIMAT0017762
Previous IDsesi-miR3460
Sequence

81 - 

ucacgagcugcagguucccuu

 - 101

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20520714 "The Ectocarpus genome and the independent evolution of multicellularity in brown algae" Cock JM, Sterck L, Rouze P, Scornet D, Allen AE, Amoutzias G, Anthouard V, Artiguenave F, Aury JM, Badger JH, Beszteri B, Billiau K, Bonnet E, Bothwell JH, Bowler C, Boyen C, Brownlee C, Carrano CJ, Charrier B, Cho GY, Coelho SM, Collen J, Corre E, Da Sil Nature. 465:617-621(2010).