Stem-loop sequence esi-MIR3469

AccessionMI0014680 (change log)
DescriptionEctocarpus siliculosus miR3469 stem-loop
Stem-loop
   a                        uc                                        uc    ug 
5'  acguugugagcuacaauccgacca  cuccgccucugggguggauaugugaacaccgucgucaucc  gaca  c
    ||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||  ||||  g
3'  ugcaacacucgauguuaggcuggu  gaggcggagaccccaccuguacacuuguggcagcgguagg  uugu  u
   -                        ga                                        --    ca 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EctsiV2) Overlapping transcripts
sctg_89: 313892-314041 [+]
intergenic
Clustered miRNAs
< 10kb from esi-MIR3469
esi-MIR3469sctg_89: 313892-314041 [+]
esi-MIR3469bsctg_89: 313918-314019 [-]
Database links

Mature sequence esi-miR3469-5p

Accession MIMAT0017763
Previous IDsesi-miR3469
Sequence

13 - 

uacaauccgaccauccuccgc

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence esi-miR3469-3p

Accession MIMAT0017764
Previous IDsesi-miR3469*
Sequence

121 - 

ggagaguggucggauuguagcuc

 - 143

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20520714 "The Ectocarpus genome and the independent evolution of multicellularity in brown algae" Cock JM, Sterck L, Rouze P, Scornet D, Allen AE, Amoutzias G, Anthouard V, Artiguenave F, Aury JM, Badger JH, Beszteri B, Billiau K, Bonnet E, Bothwell JH, Bowler C, Boyen C, Brownlee C, Carrano CJ, Charrier B, Cho GY, Coelho SM, Collen J, Corre E, Da Sil Nature. 465:617-621(2010).