Stem-loop sequence esi-MIR3467

AccessionMI0014685 (change log)
DescriptionEctocarpus siliculosus miR3467 stem-loop
   -                    c                        a             g      c     
5'  gcggacgccuucaagggcca gggaugcugcggcgagccaagacc uagucaaggguau ucccgc gcgc 
    |||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| |||||| ||| c
3'  cgccugcggaaguucccggu cccuacgacgccgcucgguucugg aucaguucccaua ggggcg cgcg 
   a                    c                        c             -      u     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EctsiV2) Overlapping transcripts
sctg_759: 7482-7624 [+]
Database links

Mature sequence esi-miR3467-5p

Accession MIMAT0017773
Previous IDsesi-miR3467*

29 - 


 - 48

Get sequence
Evidence experimental; Illumina [1]

Mature sequence esi-miR3467-3p

Accession MIMAT0017774
Previous IDsesi-miR3467

95 - 


 - 115

Get sequence
Evidence experimental; Illumina [1]


PMID:20520714 "The Ectocarpus genome and the independent evolution of multicellularity in brown algae" Cock JM, Sterck L, Rouze P, Scornet D, Allen AE, Amoutzias G, Anthouard V, Artiguenave F, Aury JM, Badger JH, Beszteri B, Billiau K, Bonnet E, Bothwell JH, Bowler C, Boyen C, Brownlee C, Carrano CJ, Charrier B, Cho GY, Coelho SM, Collen J, Corre E, Da Sil Nature. 465:617-621(2010).