Stem-loop sequence esi-MIR3462

AccessionMI0014687 (change log)
DescriptionEctocarpus siliculosus miR3462 stem-loop
Stem-loop
   c     c c             c              g a   a                 g     g  g  u 
5'  aaacg g guccuugucccgg aucccgaacgucgg u ugu gugcagccgggcucggc cacuc ug uu a
    ||||| | ||||||||||||| |||||||||||||| | ||| ||||||||||||||||| ||||| || ||  
3'  uuugc c caggagcaggguc uagggcuugcagcc a gca cacgucggcccgagccg gugag ac aa c
   u     a c             u              g c   c                 a     g  g  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EctsiV2) Overlapping transcripts
sctg_447: 45132-45281 [+]
intergenic
Database links

Mature sequence esi-miR3462-5p

Accession MIMAT0017777
Previous IDsesi-miR3462
Sequence

14 - 

uugucccggcaucccgaacgu

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence esi-miR3462-3p

Accession MIMAT0017778
Previous IDsesi-miR3462*
Sequence

119 - 

guucgggauucugggacgagg

 - 139

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20520714 "The Ectocarpus genome and the independent evolution of multicellularity in brown algae" Cock JM, Sterck L, Rouze P, Scornet D, Allen AE, Amoutzias G, Anthouard V, Artiguenave F, Aury JM, Badger JH, Beszteri B, Billiau K, Bonnet E, Bothwell JH, Bowler C, Boyen C, Brownlee C, Carrano CJ, Charrier B, Cho GY, Coelho SM, Collen J, Corre E, Da Sil Nature. 465:617-621(2010).