Stem-loop sequence mmu-mir-3472

AccessionMI0014704 (change log)
Symbol MGI:Mir3472
DescriptionMus musculus miR-3472 stem-loop
Literature search

2 open access papers mention mmu-mir-3472
(4 sentences)

Stem-loop
   --                                c 
5'   uucuuuccagcuucuggcuauuauaaauaagg u
     |||||||||||||||||||||||||||||||| g
3'   aaggaaggucgaagaccgauaauauuuauucc c
   cc                                u 
Get sequence
Deep sequencing
1133 reads, 29.3 reads per million, 58 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 145039344-145039414 [+]
sense
OTTMUST00000045501 ; Zcchc16-001; intron 2
ENSMUST00000112843 ; Zcchc16-001; intron 2
Database links

Mature sequence mmu-miR-3472

Accession MIMAT0015643
Sequence

47 - 

uaauagccagaagcuggaaggaacc

 - 71

Get sequence
Deep sequencing684 reads, 45 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).