Stem-loop sequence aae-mir-929-2

AccessionMI0014711 (change log)
DescriptionAedes aegypti miR-929-2 stem-loop
Gene family MIPF0000447; mir-929
Stem-loop
   --ug     gacu   c   a        ag         -    u 
5'     ccuac    ggu caa uugacucu  uagggaguc cuug g
       |||||    ||| ||| ||||||||  ||||||||| ||||  
3'     ggaug    cca guu gacugagg  aucccucag gagc u
   ggua     --gc   a   a        ca         u    a 
Get sequence
Deep sequencing
2644 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.2867: 3294-3382 [+]
intergenic
Database links

Mature sequence aae-miR-929

Accession MIMAT0015648
Sequence

19 - 

auugacucuaguagggagucc

 - 39

Get sequence
Deep sequencing442 reads, 2 experiments
Evidence experimental; 454 [1]

References

1