Stem-loop sequence hsv2-mir-H5

AccessionMI0014713 (change log)
DescriptionHerpes Simplex Virus 2 miR-H5 stem-loop
Gene family MIPF0000966; mir-H5
Stem-loop
          u           g  c    cac       uc  aa 
5' cucccgc ccugcgggggg cu gggc   cugaccu  gu  c
   ||||||| ||||||||||| || ||||   |||||||  ||  c
3' gagggcg gggcgcccccc ga cccg   gacugga  ca  u
          c           a  c    --a       cu  cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsv2-miR-H5

Accession MIMAT0015650
Sequence

14 - 

gggggggcucgggccaccugacc

 - 36

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).