Stem-loop sequence hsv2-mir-H6

AccessionMI0014714 (change log)
DescriptionHerpes Simplex Virus 2 miR-H6 stem-loop
Stem-loop
       uc    cuc       gc     a        cg       gca  a    gau 
5' ggcg  ggga   gcggagg  cggag auggaagg  aggggau   gg ggag   c
   ||||  ||||   |||||||  ||||| ||||||||  |||||||   || ||||    
3' ccgc  ccuu   cgccuuu  gccuc uaccuucc  ucuucua   cc ccuc   g
       ca    --u       uu     c        cg       ---  -    agg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsv2-miR-H6-5p

Accession MIMAT0015651
Previous IDshsv2-miR-H6
Sequence

28 - 

aauggaaggcgaggggaugc

 - 47

Get sequence
Evidence experimental; Illumina [1]

Mature sequence hsv2-miR-H6-3p

Accession MIMAT0015652
Previous IDshsv2-miR-H6*
Sequence

67 - 

cccaucuucugcccuuccauccu

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20181707 "Numerous conserved and divergent microRNAs expressed by herpes simplex viruses 1 and 2" Jurak I, Kramer MF, Mellor JC, van Lint AL, Roth FP, Knipe DM, Coen DM J Virol. 84:4659-4672(2010).