Stem-loop sequence nvi-mir-100

AccessionMI0014738 (change log)
DescriptionNasonia vitripennis miR-100 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   ca   -a      g   cua   c      cc  a       ---  uuuu 
5'   gcu  cuugau aca   acc guagau  ga cuugugg   gc    u
     |||  |||||| |||   ||| ||||||  || |||||||   ||     
3'   cgg  ggacug ugu   ugg caucua  cu gaacgcc   cg    u
   ug   cc      a   aca   c      uc  c       aua  uaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
GL340819.1: 29839-29938 [+]
intergenic
Clustered miRNAs
< 10kb from nvi-mir-100
nvi-mir-100GL340819.1: 29839-29938 [+]
nvi-let-7GL340819.1: 31069-31167 [+]
nvi-mir-125GL340819.1: 32632-32741 [+]
Database links

Mature sequence nvi-miR-100

Accession MIMAT0015677
Sequence

19 - 

aacccguagauccgaacuugug

 - 40

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).