Stem-loop sequence nvi-mir-125

AccessionMI0014740 (change log)
DescriptionNasonia vitripennis miR-125 stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   auaaagccu  c  - g          u  cu    cc   a       --c    c 
5'          gc gc c cgucgccggu cc  gaga  cua cuuguga   gucg g
            || || | |||||||||| ||  ||||  ||| |||||||   ||||  
3'          cg cg g guagcgguua gg  cucu  gau ggacacu   uagc u
   --aguuuuc  u  u a          u  -u    ua   c       cua    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Nvit_2.1; GCA_000002325.2) Overlapping transcripts
GL340819.1: 32632-32741 [+]
intergenic
Clustered miRNAs
< 10kb from nvi-mir-125
nvi-mir-100GL340819.1: 29839-29938 [+]
nvi-let-7GL340819.1: 31069-31167 [+]
nvi-mir-125GL340819.1: 32632-32741 [+]
Database links

Mature sequence nvi-miR-125

Accession MIMAT0015679
Sequence

27 - 

ucccugagacccuaacuuguga

 - 48

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:20075255 "Functional and evolutionary insights from the genomes of three parasitoid Nasonia species" Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Werren JH, Richards S, Desjardins CA, Niehuis O, Gadau J, Colbourne JK, Beukeboom LW, Desplan C, Elsik CG, Grimmelikhuijzen CJ, Kitts P, Lynch JA, Murphy T, Oliveira DC, Smith CD, van Science. 327:343-348(2010).