Stem-loop sequence ppy-mir-30b

Accession MI0014802
Description Pongo pygmaeus miR-30b stem-loop
Gene family MIPF0000005; mir-30
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-30_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-30 microRNA precursor is a small non-coding RNA that regulates gene expression. Animal microRNAs are transcribed as pri-miRNA (primary miRNA) of varying length which in turns are processed in the nucleus by Drosha into ~70 nucleotide stem-loop precursor called pre-miRNA (preliminary miRNA) and subsequently processed by the Dicer enzyme to give a mature ~22 nucleotide product. In this case the mature sequence comes from both the 3' (miR-30) and 5' (mir-97-6) arms of the precursor. The products are thought to have regulatory roles through complementarity to mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs. Members of the miR-30 family have been found to be highly expressed in heart cells.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
a     uu      cau          u  -a        uaaua 
 ccaag  ucaguu   guaaacaucc ac  cucagcug     c
 |||||  ||||||   |||||||||| ||  ||||||||      
 gguuc  agucga   cauuuguagg ug  gggucggu     a
a     --      cuu          -  ga        uaggu 
Get sequence
Genome context
Coordinates (PPYG2) Overlapping transcripts
8: 142865078-142865165 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-30b
ppy-mir-30d 8: 142869803-142869872 [-]
ppy-mir-30b 8: 142865078-142865165 [-]

Mature sequence ppy-miR-30b

Accession MIMAT0015736
Sequence

17 - 

uguaaacauccuacacucagcu

 - 38

Get sequence
Evidence not experimental

References

1