Stem-loop sequence ppy-mir-135b

Accession MI0014828
Description Pongo pygmaeus miR-135b stem-loop
Gene family MIPF0000028; mir-135
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-135_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-135 microRNA precursor is a small non-coding RNA that is involved in regulating gene expression. It has been shown to be expressed in human, mouse and rat. miR-135 has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000028). Precursor microRNAs are ~70 nucleotides in length and are processed by the Dicer enzyme to produce the shorter 21-24 nucleotide mature sequence. In this case the mature sequence is excised from the 5' arm of the hairpin.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop 
-------ca    -                   cau          --   cu 
         cucu gcuguggccuauggcuuuu   uccuauguga  uug  g
         |||| |||||||||||||||||||   ||||||||||  |||   
         ggga ugacaucggguaccgaaaa   gggauguacu  aac  u
ccucgaacg    g                   -uc          ca   cc
Get sequence
Genome context
Coordinates (PPYG2) Overlapping transcripts
1: 44744545-44744641 [+]
intergenic

Mature sequence ppy-miR-135b

Accession MIMAT0015758
Sequence

16 -  

uauggcuuuucauuccuauguga

 - 38

Get sequence
Evidence not experimental

References

1
PMID:20214803 "Genome-wide comparative analysis of microRNAs in three non-human primates" Brameier M BMC Res Notes. 3:64(2010).