|
miRBase |
|
Stem-loop sequence ppy-mir-135b |
|||||
| Accession | MI0014828 | ||||
| Description | Pongo pygmaeus miR-135b stem-loop | ||||
| Gene family | MIPF0000028; mir-135 | ||||
| Community annotation |
This text is a summary paragraph taken from the Wikipedia entry entitled mir-135_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ... The miR-135 microRNA precursor is a small non-coding RNA that is involved in regulating gene expression. It has been shown to be expressed in human, mouse and rat. miR-135 has now been predicted or experimentally confirmed in a wide range of vertebrate species (MIPF0000028). Precursor microRNAs are ~70 nucleotides in length and are processed by the Dicer enzyme to produce the shorter 21-24 nucleotide mature sequence. In this case the mature sequence is excised from the 5' arm of the hairpin. |
||||
| Stem-loop |
-------ca - cau -- cu cucu gcuguggccuauggcuuuu uccuauguga uug g |||| ||||||||||||||||||| |||||||||| ||| ggga ugacaucggguaccgaaaa gggauguacu aac u ccucgaacg g -uc ca cc |
||||
| Genome context |
|
||||
Mature sequence ppy-miR-135b |
|
| Accession | MIMAT0015758 |
| Sequence |
16 - uauggcuuuucauuccuauguga - 38 |
| Evidence | not experimental |
References |
|
| 1 |
PMID:20214803
"Genome-wide comparative analysis of microRNAs in three non-human primates"
BMC Res Notes. 3:64(2010).
|