Stem-loop sequence ppy-mir-142

AccessionMI0014833 (change log)
DescriptionPongo pygmaeus miR-142 stem-loop
Gene family MIPF0000084; mir-142
Stem-loop
   g        g   c           a         uaa ag a 
5'  acagugca uca ccauaaaguag aagcacuac   c  c c
    |||||||| ||| ||||||||||| |||||||||   |  |  
3'  ugucaugu agu gguauuucauc uuugugaug   g  g u
   g        g   a           c         -ug ga g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr17: 33814033-33814119 [+]
intergenic
Database links

Mature sequence ppy-miR-142-5p

Accession MIMAT0015765
Sequence

16 - 

cauaaaguagaaagcacuacu

 - 36

Get sequence
Evidence not experimental

Mature sequence ppy-miR-142-3p

Accession MIMAT0015766
Sequence

52 - 

uguaguguuuccuacuuuaugga

 - 74

Get sequence
Evidence not experimental

References

1