Stem-loop sequence ppy-mir-377

AccessionMI0014925 (change log)
DescriptionPongo pygmaeus miR-377 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   uu              c   -    a    - uuu 
5'   gagcagagguugcc uug guga uucg c   a
     |||||||||||||| ||| |||| |||| |   u
3'   uuuguuuucaacgg aac cacu aagu g   u
   -g              a   a    -    u uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 102624784-102624852 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-377
ppy-mir-382chr14: 102616490-102616565 [+]
ppy-mir-134chr14: 102616871-102616943 [+]
ppy-mir-668chr14: 102617958-102618024 [+]
ppy-mir-485chr14: 102618120-102618192 [+]
ppy-mir-453chr14: 102618891-102618970 [+]
ppy-mir-154chr14: 102622472-102622555 [+]
ppy-mir-496chr14: 102623301-102623402 [+]
ppy-mir-377chr14: 102624784-102624852 [+]
ppy-mir-541chr14: 102627217-102627300 [+]
ppy-mir-409chr14: 102628022-102628100 [+]
ppy-mir-412chr14: 102628169-102628259 [+]
ppy-mir-369chr14: 102628320-102628389 [+]
ppy-mir-410chr14: 102628634-102628713 [+]
ppy-mir-656chr14: 102629436-102629513 [+]
Database links

Mature sequence ppy-miR-377

Accession MIMAT0015867
Sequence

45 - 

aucacacaaaggcaacuuuugu

 - 66

Get sequence
Evidence not experimental

References

1