Stem-loop sequence ppy-mir-429

AccessionMI0014942 (change log)
DescriptionPongo pygmaeus miR-429 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   cgccg  c        -uc          ug       cugg 
5'      gc gaugggcg   uuaccagaca  guuagac    c
        || ||||||||   ||||||||||  |||||||     
3'      cg cuaccugc   aauggucugu  uaaucug    c
   -----  c        caa          ca       ucug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 229421350-229421429 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-429
ppy-mir-200achr1: 229422413-229422500 [-]
ppy-mir-429chr1: 229421350-229421429 [-]
Database links

Mature sequence ppy-miR-429

Accession MIMAT0015886
Sequence

51 - 

uaauacugucugguaaaaccgu

 - 72

Get sequence
Evidence not experimental

References

1