Stem-loop sequence ppy-mir-487a

AccessionMI0014959 (change log)
DescriptionPongo pygmaeus miR-487a stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
         u     g   uua      c    -    c   a 
5' gguacu gaaga ugg   ucccug ugug uucg uua u
   |||||| ||||| |||   |||||| |||| |||| ||| u
3' cuauga uuuuu acc   agggac auac aagc agu u
         c     g   uac      -    u    -   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 102614611-102614690 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-487a
ppy-mir-1185-1chr14: 102605109-102605194 [+]
ppy-mir-1185-2chr14: 102606330-102606415 [+]
ppy-mir-381chr14: 102608058-102608132 [+]
ppy-mir-487bchr14: 102608591-102608674 [+]
ppy-mir-539chr14: 102609453-102609530 [+]
ppy-mir-889chr14: 102610033-102610111 [+]
ppy-mir-544chr14: 102610806-102610896 [+]
ppy-mir-655chr14: 102611698-102611794 [+]
ppy-mir-487achr14: 102614611-102614690 [+]
ppy-mir-382chr14: 102616490-102616565 [+]
ppy-mir-134chr14: 102616871-102616943 [+]
ppy-mir-668chr14: 102617958-102618024 [+]
ppy-mir-485chr14: 102618120-102618192 [+]
ppy-mir-453chr14: 102618891-102618970 [+]
ppy-mir-154chr14: 102622472-102622555 [+]
ppy-mir-496chr14: 102623301-102623402 [+]
Database links

Mature sequence ppy-miR-487a

Accession MIMAT0015905
Sequence

49 - 

aaucauacagggacauccaguu

 - 70

Get sequence
Evidence not experimental

References

1