Stem-loop sequence ppy-mir-543

AccessionMI0015041 (change log)
DescriptionPongo pygmaeus miR-543 stem-loop
Gene family MIPF0000110; mir-329
Stem-loop
   --    u  u       u  -     ---u    u    uu 
5'   uacu aa gagaagu gc ccgug    uuuu ucgc  u
     |||| || ||||||| || |||||    |||| ||||  a
3'   auga uu uucuuca cg ggcgc    aaag agug  u
   cu    c  u       -  u     uuac    c    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 102593436-102593513 [+]
intergenic
NW_002955896.1: 6461-6538 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-543
ppy-mir-379chr14: 102583478-102583544 [+]
ppy-mir-411chr14: 102584737-102584832 [+]
ppy-mir-299chr14: 102585203-102585265 [+]
ppy-mir-380chr14: 102586431-102586490 [+]
ppy-mir-1197chr14: 102586977-102587064 [+]
ppy-mir-323chr14: 102587145-102587230 [+]
ppy-mir-758chr14: 102587434-102587521 [+]
ppy-mir-329-1chr14: 102588199-102588278 [+]
ppy-mir-329-2chr14: 102588514-102588596 [+]
ppy-mir-494chr14: 102591073-102591153 [+]
ppy-mir-1193chr14: 102591485-102591597 [+]
ppy-mir-543chr14: 102593436-102593513 [+]
ppy-mir-495chr14: 102595205-102595283 [+]
ppy-mir-376cchr14: 102601818-102601883 [+]
ppy-mir-376a-2chr14: 102602202-102602281 [+]
ppy-mir-654chr14: 102602352-102602432 [+]
ppy-mir-376bchr14: 102602569-102602668 [+]
ppy-mir-376a-1chr14: 102602915-102602982 [+]
Database links

Mature sequence ppy-miR-543

Accession MIMAT0015993
Sequence

47 - 

aaacauucgcggugcacuucuu

 - 68

Get sequence
Evidence not experimental

References

1