Stem-loop sequence ppy-mir-544

AccessionMI0015042 (change log)
DescriptionPongo pygmaeus miR-544 stem-loop
Gene family MIPF0000436; mir-544
Stem-loop
   auuuu      cua    u           -     u   -ga  c 
5'      caucac   ggga cuuguuaaaaa gcaga ucu   uu a
        ||||||   |||| ||||||||||| ||||| |||   ||  
3'      guagug   cucu gaacgauuuuu cgucu aga   ag g
   uaauc      -aa    u           a     u   acc  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 102610806-102610896 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-544
ppy-mir-376cchr14: 102601818-102601883 [+]
ppy-mir-376a-2chr14: 102602202-102602281 [+]
ppy-mir-654chr14: 102602352-102602432 [+]
ppy-mir-376bchr14: 102602569-102602668 [+]
ppy-mir-376a-1chr14: 102602915-102602982 [+]
ppy-mir-300chr14: 102603492-102603574 [+]
ppy-mir-1185-1chr14: 102605109-102605194 [+]
ppy-mir-1185-2chr14: 102606330-102606415 [+]
ppy-mir-381chr14: 102608058-102608132 [+]
ppy-mir-487bchr14: 102608591-102608674 [+]
ppy-mir-539chr14: 102609453-102609530 [+]
ppy-mir-889chr14: 102610033-102610111 [+]
ppy-mir-544chr14: 102610806-102610896 [+]
ppy-mir-655chr14: 102611698-102611794 [+]
ppy-mir-487achr14: 102614611-102614690 [+]
ppy-mir-382chr14: 102616490-102616565 [+]
ppy-mir-134chr14: 102616871-102616943 [+]
ppy-mir-668chr14: 102617958-102618024 [+]
ppy-mir-485chr14: 102618120-102618192 [+]
ppy-mir-453chr14: 102618891-102618970 [+]
Database links

Mature sequence ppy-miR-544

Accession MIMAT0015994
Sequence

55 - 

auucugcauuuuuagcaaguuc

 - 76

Get sequence
Evidence not experimental

References

1