Stem-loop sequence ppy-mir-668

AccessionMI0015136 (change log)
DescriptionPongo pygmaeus miR-668 stem-loop
Gene family MIPF0000357; mir-668
Stem-loop
       a   c   ---        g         aa 
5' ggua gug gcc   ucggguga caugcacuu  u
   |||| ||| |||   |||||||| |||||||||   
3' ccau cac cgg   ggcucacu guaugugga  g
       -   c   cuc        -         gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 102617958-102618024 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-668
ppy-mir-381chr14: 102608058-102608132 [+]
ppy-mir-487bchr14: 102608591-102608674 [+]
ppy-mir-539chr14: 102609453-102609530 [+]
ppy-mir-889chr14: 102610033-102610111 [+]
ppy-mir-544chr14: 102610806-102610896 [+]
ppy-mir-655chr14: 102611698-102611794 [+]
ppy-mir-487achr14: 102614611-102614690 [+]
ppy-mir-382chr14: 102616490-102616565 [+]
ppy-mir-134chr14: 102616871-102616943 [+]
ppy-mir-668chr14: 102617958-102618024 [+]
ppy-mir-485chr14: 102618120-102618192 [+]
ppy-mir-453chr14: 102618891-102618970 [+]
ppy-mir-154chr14: 102622472-102622555 [+]
ppy-mir-496chr14: 102623301-102623402 [+]
ppy-mir-377chr14: 102624784-102624852 [+]
ppy-mir-541chr14: 102627217-102627300 [+]
Database links

Mature sequence ppy-miR-668

Accession MIMAT0016095
Sequence

44 - 

ugucacucggcucggcccacuac

 - 66

Get sequence
Evidence not experimental

References

1