Stem-loop sequence ppy-mir-889

AccessionMI0015159 (change log)
DescriptionPongo pygmaeus miR-889 stem-loop
Gene family MIPF0000514; mir-889
Stem-loop
   --     u   g     c      uagua     -  uau 
5'   gugcu aaa aaugg uguccg     ugguc uc   a
     ||||| ||| ||||| ||||||     ||||| ||   u
3'   uauga uuu uuacc acaggc     auuag ag   u
   cc     u   g     a      -uaua     u  uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 102610033-102610111 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-889
ppy-mir-376cchr14: 102601818-102601883 [+]
ppy-mir-376a-2chr14: 102602202-102602281 [+]
ppy-mir-654chr14: 102602352-102602432 [+]
ppy-mir-376bchr14: 102602569-102602668 [+]
ppy-mir-376a-1chr14: 102602915-102602982 [+]
ppy-mir-300chr14: 102603492-102603574 [+]
ppy-mir-1185-1chr14: 102605109-102605194 [+]
ppy-mir-1185-2chr14: 102606330-102606415 [+]
ppy-mir-381chr14: 102608058-102608132 [+]
ppy-mir-487bchr14: 102608591-102608674 [+]
ppy-mir-539chr14: 102609453-102609530 [+]
ppy-mir-889chr14: 102610033-102610111 [+]
ppy-mir-544chr14: 102610806-102610896 [+]
ppy-mir-655chr14: 102611698-102611794 [+]
ppy-mir-487achr14: 102614611-102614690 [+]
ppy-mir-382chr14: 102616490-102616565 [+]
ppy-mir-134chr14: 102616871-102616943 [+]
ppy-mir-668chr14: 102617958-102618024 [+]
ppy-mir-485chr14: 102618120-102618192 [+]
ppy-mir-453chr14: 102618891-102618970 [+]
Database links

Mature sequence ppy-miR-889

Accession MIMAT0016124
Sequence

49 - 

uuaauaucggacaaccauugu

 - 69

Get sequence
Evidence not experimental

References

1