Stem-loop sequence sja-mir-2a

AccessionMI0015283 (change log)
DescriptionSchistosoma japonicum miR-2a stem-loop
Gene family MIPF0001838; mir-2_2
Literature search

9 open access papers mention sja-mir-2a
(31 sentences)

Stem-loop
   a   u    a   -ca              a     uug 
5'  ccu uugc ccg   gucaauauuggcug uggca   u
    ||| |||| |||   |||||||||||||| |||||   u
3'  gga aaug ggc   uaguuaugaccgac acugu   u
   -   u    g   aag              -     uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01007682.1: 2964-3041 [-]
intergenic
Clustered miRNAs
< 10kb from sja-mir-2a
sja-mir-71aCABF01007682.1: 3056-3135 [-]
sja-mir-2aCABF01007682.1: 2964-3041 [-]
sja-mir-2bCABF01007682.1: 2869-2946 [-]
sja-mir-2eCABF01007682.1: 2769-2851 [-]
Database links

Mature sequence sja-miR-2a-5p

Accession MIMAT0016245
Sequence

14 - 

cagucaauauuggcugauggca

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sja-miR-2a-3p

Accession MIMAT0016246
Sequence

47 - 

ucacagccaguauugaugaacg

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).