Stem-loop sequence sja-mir-2b

AccessionMI0015284 (change log)
DescriptionSchistosoma japonicum miR-2b stem-loop
Gene family MIPF0000049; mir-2
Literature search

8 open access papers mention sja-mir-2b
(28 sentences)

Stem-loop
   --      u  - c       --   a      gc  acgu 
5'   aggugg gc g gucucaa  agg cuguga  ca    a
     |||||| || | |||||||  ||| ||||||  ||     
3'   uccauc cg c caggguu  ucc gacacu  gu    a
   cg      -  a a       cg   c      au  cauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01007682.1: 2869-2946 [-]
intergenic
Clustered miRNAs
< 10kb from sja-mir-2b
sja-mir-71aCABF01007682.1: 3056-3135 [-]
sja-mir-2aCABF01007682.1: 2964-3041 [-]
sja-mir-2bCABF01007682.1: 2869-2946 [-]
sja-mir-2eCABF01007682.1: 2769-2851 [-]
Database links

Mature sequence sja-miR-2b-5p

Accession MIMAT0016247
Sequence

11 - 

cgucucaaaggacugugagcca

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sja-miR-2b-3p

Accession MIMAT0016248
Sequence

45 - 

uaucacagcccugcuugggacaca

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).