Stem-loop sequence sja-mir-7

AccessionMI0015285 (change log)
DescriptionSchistosoma japonicum miR-7 stem-loop
Literature search

7 open access papers mention sja-mir-7
(36 sentences)

Stem-loop
   -au   --   -     uuaau         cug      u      gauugaugaaaguuuuaaguauuucauaa 
5'    guu  gcc guugc     cauggaaga   gugaua guuguu                             u
      |||  ||| |||||     |||||||||   |||||| ||||||                              
3'    caa  ugg uaacg     guaccuucu   cgcuau caacaa                             u
   cuu   gu   a     --uau         -ua      u      gcauuauaguaacaaaacuacuucgaaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01039688.1: 5408-5554 [+]
intergenic
Database links

Mature sequence sja-miR-7-5p

Accession MIMAT0016249
Sequence

21 - 

uggaagacuggugauauguuguu

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sja-miR-7-3p

Accession MIMAT0016250
Sequence

106 - 

caacuuaucgcauucuuccaug

 - 127

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).