Stem-loop sequence sja-mir-8

AccessionMI0015286 (change log)
DescriptionSchistosoma japonicum miR-8 stem-loop
Gene family MIPF0000019; mir-8
Literature search

4 open access papers mention sja-mir-8
(16 sentences)

Stem-loop
   ---a     a         --a           u  uaaa 
5'     ugagu uggcaucuu   cuaauaguauu ga    g
       ||||| |||||||||   ||||||||||| ||     
3'     acucg accguagaa   gauugucauaa cu    a
   cuuc     -         aug           u  uuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01051237.1: 644-719 [+]
intergenic
Database links

Mature sequence sja-miR-8-5p

Accession MIMAT0016251
Sequence

11 - 

caucuuacuaauaguauuuga

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sja-miR-8-3p

Accession MIMAT0016252
Sequence

44 - 

uaauacuguuagguaaagaugcc

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).