Stem-loop sequence sja-mir-10

Accession

MI0015287 (change log)

Description

Schistosoma japonicum miR-10 stem-loop

Gene family

MIPF0000033; mir-10

Literature search

8 open access papers mention sja-mir-10
(22 sentences)

Stem-loop

   --  uc     -gaa  c       c        g  gcc 
5'   cc  aguau    cc uguagac cgaguuug au   g
     ||  |||||    || ||||||| |||||||| ||    
3'   gg  ucaua    gg auaucug gcuuaaac ua   u
   aa  uu     gaaa  a       a        g  gau 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (ASM15177v1; GCA_000151775.1): CABF01007487.1: 6178-6256 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0015287

Mature sequence sja-miR-10-5p

• Accession: MIMAT0016253
• Sequence: 11 - aacccuguagacccgaguuugg - 32
• Evidence: experimental; Illumina [1]

Mature sequence sja-miR-10-3p

• Accession: MIMAT0016254
• Sequence: 47 - aaauucgagucuauaaggaaaga - 69
• Evidence: experimental; Illumina [1]

References

1. PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).