Stem-loop sequence sja-mir-31

AccessionMI0015288 (change log)
DescriptionSchistosoma japonicum miR-31 stem-loop
Gene family MIPF0001803; mir-31_2
Literature search

4 open access papers mention sja-mir-31
(43 sentences)

Stem-loop
   --     g             uac  c         u  aau 
5'   uauuu uuguuggcaagau   gg gaagcugaa ca   u
     ||||| |||||||||||||   || ||||||||| ||   u
3'   augga aauaaccguuuua   uc cuucgacuu gu   a
   cg     -             -uu  a         u  aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01027063.1: 2598-2680 [-]
intergenic
Database links

Mature sequence sja-miR-31-5p

Accession MIMAT0016255
Sequence

11 - 

uggcaagauuacggcgaagcuga

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sja-miR-31-3p

Accession MIMAT0016256
Sequence

53 - 

agcuucacuuuauuuugccaa

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).