Stem-loop sequence sja-mir-36

AccessionMI0015289 (change log)
DescriptionSchistosoma japonicum miR-36 stem-loop
Gene family MIPF0000096; mir-36
Literature search

8 open access papers mention sja-mir-36
(20 sentences)

Stem-loop
   --uauag        -     c g       ca   auucaacaauc 
5'        cuugcgaa gaaug c auccggu  gcc           u
          |||||||| ||||| | |||||||  |||           a
3'        gaacgcuu cuuac g ugggcca  cgg           u
   uauuaua        a     a a       -c   caaauaaugac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01004852.1: 272-364 [-]
intergenic
Database links

Mature sequence sja-miR-36-5p

Accession MIMAT0016257
Sequence

11 - 

gaagaaugccgauccggucagcc

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sja-miR-36-3p

Accession MIMAT0016258
Sequence

61 - 

ccaccggguagacauucauucgc

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).