Stem-loop sequence sja-mir-61

AccessionMI0015290 (change log)
DescriptionSchistosoma japonicum miR-61 stem-loop
Gene family MIPF0001758; mir-61_2
Literature search

3 open access papers mention sja-mir-61
(6 sentences)

Stem-loop
   --------------------------------------------------cauucuaacuuuacau     --ga     aa    a  -c   ucc 
5'                                                                   cacau    cuaga  gugc cu  acu   a
                                                                     |||||    |||||  |||| ||  |||    
3'                                                                   gugua    gauuu  uacg ga  uga   u
   auuauuuagauguuauguguaacuugaaugcguuuaaaugcauuguaucccuuaaaaaugacaccu     aaga     ac    a  ca   cuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01036171.1: 1214-1356 [+]
intergenic
Database links

Mature sequence sja-miR-61

Accession MIMAT0016259
Sequence

21 - 

ugacuagaaagugcacucacuu

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).