Stem-loop sequence sja-mir-124

AccessionMI0015292 (change log)
DescriptionSchistosoma japonicum miR-124 stem-loop
Gene family MIPF0000021; mir-124
Literature search

8 open access papers mention sja-mir-124
(21 sentences)

Stem-loop
   --uaua  u   c     u     au         ---     aaaa   a 
5'       ug aug cauuu ccgcg  ugccuugau   uuguu    gaa a
         || ||| ||||| |||||  |||||||||   |||||    ||| u
3'       ac uac guaag ggcgc  acggaauua   aacaa    cuu g
   cguggc  c   u     u     --         uaa     --ca   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01021699.1: 6318-6413 [+]
intergenic
Database links

Mature sequence sja-miR-124-5p

Accession MIMAT0016262
Sequence

11 - 

ccauuuuccgcgauugccuugauuu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sja-miR-124-3p

Accession MIMAT0016263
Sequence

66 - 

uaaggcacgcggugaauguca

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).