Stem-loop sequence sja-mir-133

AccessionMI0015293 (change log)
DescriptionSchistosoma japonicum miR-133 stem-loop
Literature search

1 open access papers mention sja-mir-133
(3 sentences)

Stem-loop
   caugcuguucuuaugagauuuuggucccuaucaaccagcuguaguggauagcuuca   u a     a  -  -uacu    uucu    gcc 
5'                                                         uca c gacau cu gu     uguu    auau   u
                                                           ||| | ||||| || ||     ||||    ||||   u
3'                                                         agu g uugua ga ca     auaa    ugua   u
   ---------------------------------------------auaagguuuaa   u a     a  a  uuuau    uuuu    agc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01070535.1: 1141-1282 [+]
intergenic
Database links

Mature sequence sja-miR-133

Accession MIMAT0016264
Sequence

21 - 

uuggucccuaucaaccagcugu

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).