Stem-loop sequence sja-mir-190

AccessionMI0015294 (change log)
DescriptionSchistosoma japonicum miR-190 stem-loop
Gene family MIPF0001853; mir-190_2
Literature search

3 open access papers mention sja-mir-190
(5 sentences)

Stem-loop
   -cgacag        u     -u       aug       u     ---------ca        ca 
5'        uaaacugg cgaug  gauaugu   gguuacu ggugu           gcggauaa  u
          |||||||| |||||  |||||||   ||||||| |||||           ||||||||   
3'        auuugauu gcuau  cuauaca   ccaguga ccaca           cgcuuauu  g
   cuccuag        c     cc       -ga       -     uaacgaauuac        uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01003857.1: 2236-2358 [+]
intergenic
Database links

Mature sequence sja-miR-190-5p

Accession MIMAT0016265
Sequence

21 - 

ugauauguauggguuacuuggug

 - 43

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sja-miR-190-3p

Accession MIMAT0016266
Sequence

84 - 

cagugaccagacauaucccu

 - 103

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).