Stem-loop sequence sja-mir-219

AccessionMI0015295 (change log)
DescriptionSchistosoma japonicum miR-219 stem-loop
Gene family MIPF0000044; mir-219
Literature search

3 open access papers mention sja-mir-219
(5 sentences)

Stem-loop
   ucu    ---ac        cac    u       c           uagaaacauuuucaauuauuaucauua 
5'    guga     aaucgauu   ugau guccauu gcauuucuugu                           u
      ||||     ||||||||   |||| ||||||| |||||||||||                           u
3'    uacu     uuagcuag   acua cagguaa uguggagaaca                           c
   -uc    aauua        uau    -       u           cuuaauuuauaauaguaguaauaguaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01007005.1: 4661-4806 [-]
intergenic
Database links

Mature sequence sja-miR-219-5p

Accession MIMAT0016267
Sequence

21 - 

ugauuguccauucgcauuucu

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sja-miR-219-3p

Accession MIMAT0016268
Sequence

105 - 

agagguguuaauggacaucaua

 - 126

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).